Introduction

The genus Lilium is an important ornamental plant. Lilium bulbs are considered Chinese medicine and a healthy food (Zhou et al. 2012; Tang et al. 2014). Lilium pumilum DC. (L. pumilum) is a wild lily species distributed in Northeast China. L. pumilum is valuable not only for its beautiful flowers, edible properties and medicinal usage but also for its high adaptability to soil conditions and resistance to drought and salinity (Zhao et al. 1996; Proscevičius 2010). Therefore, this research selected L. pumilum as an ideal material for investigating the gene salinity tolerance of Lilium.

The PHB1 protein was identified with anti-proliferative activity and was hence named prohibitin (McClung et al. 1989). Prohibitins constitute a family of evolutionarily conserved proteins, comprising two highly homologous PHB1 and PHB2 subunits. PHB not only controls cell lifespan and plant growth (Coates et al. 1997; Merkwirth et al. 2008; Merkwirth and Langer 2009; Lee et al. 2015) but also has some relationship with stress in plants, such as knockdown of AtPHB3 and AtPHB4, which can improve stress-related transcript abundance (Aken et al. 2007). Prohibitin expression was induced by high or light metabolic stress (Vandenabeele et al. 2003; Sieger et al. 2005). The gene expression level of rice prohibitin was changed in a rice lesion-mimic mutant (Takahashi et al. 2003). Arabidopsis atPHB3 mutants appeared more resistant to salt stress than the wild type under NaCl treatment (Wang et al. 2010). The Caenorhabditis elegans phb mutant caused increased sensitivity to oxidative stress (Artal-Sanz et al. 2003). PHB-silenced tobacco was more susceptible to H₂O₂ induced by oxidative stresses (Ahn et al. 2006). AtPHB3 regulates salicylic acid biosynthesis, which is induced by stress (Seguel et al. 2018). Low PHB1 or PHB2 expression was associated with increased ROS (Zhou et al. 2014).

In this study, the LpPHB3 gene was isolated from an L. pumilum bulb grown under 20 mM NaHCO₃ stress. LpPHB3 was overexpressed in transgenic L. pumilum. Transgenic L. pumilum had more resistant to salt and oxidative stress than wild type. The physiological index between transgenic and wild type L. pumilum was analyzed. The homeostasis ratios of K⁺ and Na⁺ between transgenic plants and wild type plants under stress were compared. The intercellular ROS content and the expression of genes related to ROS (APX; CAT; AOX1a; NDB1) in transgenic plants and wild type plants were compared. LpPHB3 overexpression reduces the damage of salt to plants maybe by reducing or eliminating excessive ROS in the plants. PHB3 has been relatively little studied in plants. The study of LpPHB3 not only benefited our understanding of the stress-associated function of this gene in Lilium but also can improve the stress tolerance of other plants by introducing this gene into plants in the future.

Materials and Methods

Obtaining the open reading frame (ORF) region of LpPHB3

Total RNA of two-month-old tissue culture seedlings and was extracted using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). cDNA was synthesized by PrimeScript reverse transcriptase (Takara, Tokyo, Japan). The PCR product was obtained with the primers listed in Table 1 and ligated with pMD18-T (Takara, Tokyo, Japan). Then, sequences of the deduced protein were used as queries for conserved domain and blast studies in NCBI. A multiple sequence alignment was constructed with DNAMAN8. MEGA 3.0 was used for phylogenetic analysis. The new gene was named LpPHB3 (NCBI number: MH319853).

LpPHB3 expression in L. pumilum

Total RNA of L. pumilum roots, leaves, shoots, flowers and seeds was extracted and cDNA was synthesized. qPCR analysis was performed using SYBR Green (TaKaRa, Tokyo, Japan). The lilyActin gene (the NCBI number: JX826390) as the reference (Liang et al. 2013), the LpPHB3 and lilyActin gene primers for qPCR are listed in Table 1.

Two-month-old L. pumilum seedlings grown on MS medium (Murashige and Skoog 1962) in culture bottles were transferred to fresh MS medium either with 200 mM NaCl, 30 mM,15 mM H₂O₂ or no stress. The expression of LpPHB3 in bulbs after 0, 6, 12, 24, 36, and 48 h stress was detected by qPCR.

Identification of transgenic L. pumilum

pMD18T-LpPHB3 plasmid DNA was amplified with primers LpPHB3-BamH1F and LpPHB3-SacI R (listed in Table 1). The PCR product was digested by BamHI / SacI and ligated to the BamHI/SacI double digestion of vector pBI121. The pBI121-LpPHB3 plasmid was transformed into strain EHA105 (Agrobacterium tumefaciens), which was then transformed into L. pumilum scale through Agrobacterium-mediated transformation (Cáceres et al. 2011). Transgenic scale was germinated on kanamycin-selective MS+2 mg/L 6BA+0.5 mg/L NAA medium at first, when plants differentiated from scales, the region of the PBI121 vector carrying LpPHB3 was amplified from the DNA of 6 independent transgenic L. pumilum leaves using the PBI121 forward and reverse primers we designed (primers are listed in Table 1). Finally, five transgenic lines (except #5) were selected and analyzed by qPCR to confirm that the transformation was successful; the LpPHB3 and lilyActin gene primers for qPCR are listed in Table 1, and the protocol is described above. The transgenic lines (#2, #3, and #4) were used for all further analyses.

Stress tolerance compared with the wild type and the transgenic L. pumilum

The two-month-old wild type and transgenic lines (#2, #3, #4), which grew in culture bottles with the same growth status, were transplanted into MS medium either with 200 mM NaCl, 20 mM NaHCO₃ or 20 mM H₂O₂ or without for 48 h to observe the leaf phenotypic characteristics.

Two-month-old wild type and transgenic seedings were transferred to pots containing nutrient soil. After another 2 weeks of growth, the pots were irrigated with 50 mL solution of 300 mm NaCl, 300 mm NaHCO₃ or 2 M H₂O₂ for 3 times every 4 days. The pots container is covered with a breathable plastic cover to minimize evaporation and keep the concentration of the solution from changing too much. Images of the plant were taken after 12 days of treatment.

Measurements of physiological indices of L. pumilum under the stresses

Seedlings of two-month-old wild type and transgenic plants of the same size were placed in MS medium either with 200 mM NaCl, 20 mM NaHCO₃ or 20 mM H₂O₂ or without. The leaves were harvested after 48 h to measure the physiological indices, and the proline content was estimated as described by Bates (Bates et al. 1973). MDA content is estimated as describing by Heath (Heath and Packer 1968). The total chlorophyll content was determined as described by Arnon (Tu et al. 2016). Electrolyte leakage measured using the conductometer (Cen et al. 2016).

K⁺ and Na⁺ content in L. pumilum under stresses

Two-month-old wild type and transgenic L. pumilum were cultured in 200 mM NaCl or 20 mM NaHCO₃ or no stress MS medium for 48 h. The dried bulbs were digested with HNO₃ and HClO (87:13, v/v) then 2.5% HNO₃ diluted, and the ion content was measured by atomic absorption spectrophotometry (AA800, Perkin Elmer, USA).

Noninvasive microtest technology (NMT) measured net K⁺ and Na⁺ flux

Two-month-old wild type and transgenic seedlings were transplanted onto MS medium either with 200 mM NaCl or 20 mM NaHCO₃ or without for 48 h. NMT (Younger USA LLC, Amherst, USA), as well as with iFluxes/imFluxes 1.0 software, was used to measure the K⁺ and Na⁺ fluxes of plant roots as described previously (Xin et al. 2014).

Reaction to ROS stress in transgenic L. pumilum

To investigate whether the LpPHB3 protein is related to ROS stress, the two-month-old wild type and transgenic Table 1: Names and sequences of forward and reverse primers for PCR amplification of LpPHB3

Name	Sequence (5′-3′)	Length (bp)
LpPHB3-F	ATGGGCTCCAACCCCCAAGC	846 bp
LpPHB3-R	TCACCGTCCTGCGGTGTTGA
LpPHB3-BamH1F	GGATCCATGGGCTCCAACCCCCA	858 bp
LpPHB3-SacI R	CCGCGGTCATTTGCAGGTGCAT
PBI 121-F	TCATTTCATTTGGAGAGAACAC	1000bp
PBI 121-R	TTGCCAAATGTTTGAACGATC
lilyActin-F	GCATCACACCTTCTACAACG	286 bp
lilyActin-R	GAAGAGCATAACCCTCATAGA
qLpAPX-F	GTTGTTGCCGTGGAAGTGAC	226 bp
qLpAPX-R	CCTCATAGCCTGACCGTTCC
qLpCAT-F	TGTGCTGATTTCATGCGTGC	292 bp
qLpCAT-R	GGCTTTCCGGATGGTGAGAA
qLpAOX-F	ACAAGCTCGCGTTTTGGATG	263 bp
qLpAOX-R	GCGTTCGTACCATCTAGGCT
qNDB-F	GCACGTAGCATTGTTGAGCC	239 bp
qNDB-R	TGACAATGCTCCTCCACACC

Fig. 1: Conserved domain analysis indicated that LpPHB3 has a conserved PHB domain and belongs to PHB family

Fig. 2: Alignment of the LpPHB3 deduced amino acid sequence with PHB3 proteins from other plant species. The amino acid sequence of this transcript was similar to that of the HaPHB3 protein (XP_022011535.1, 83.33%) from Helianthus annuus, MePHB3 protein (XP_021599581.1, 83.27%) from Manihot esculenta, AmPHB3 protein (XP_006842332.1, 83.10%) from Amborella trichopoda, AsPHB3 protein (PKA61440.1, 82.46%) from Apostasia shenzhenica, PaPHB3 protein (XP_021825041.1, 81.85%) from Prunus avium, and AtPHB3 (NP_198893.1, 78%) from Arabidopsis thaliana

plants were treated with 0 (control), 200 mM NaCl, 20 mM NaHCO₃ or 20 mM H₂O₂ for 48 h. The accumulation of H₂O₂ and O₂^- in plant leaves was observed through staining with 3,3'-diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) (Hoffmann et al. 2005). The stained rosettes were observed under a microscope (Olympus).

The expression of four ROS stress-related genes (APX, CAT, AOX, NDB) in wild type and transgenic plants either with 200 mM NaCl, 20 mM NaHCO₃ or 15 mM H₂O₂ or without was examined by qPCR. Primers used for qPCR were designed according to the L. pumilum transcriptomes that were analyzed by the company. The primers for actin and the four stress-related genes used for qPCR are listed in Table 1. The same protocol in the “LpPHB3 gene expression in L. pumilum” section was performed.

Statistical analysis

All treatments were performed in triplicates and analysing the variance using SPSS for Windows version 11.5, significant differences at a level P < 0.05.

Results

Cloning of the LpPHB3 ORF region

The LpPHB3 ORF containing 846 bp, encoding 281 amino acids, was obtained from L. pumilum cDNA

.

Fig. 3: Phylogenetic tree of 20 selected plant PHB3 proteins. The MEGA3 program was used for the construction of phylogenetic trees. Bar represents 0.1 amino acid substitutions per site

Fig. 4: Organ distribution of LpPHB3 expression in L. pumilum and detection of LpPHB3-relative expression under the stresses. (A). LpPHB3 relative expression in different organs of L. pumilum. (B). Relative expression of the LpPHB3 gene under 200 mM NaCl treatment. (C). Relative expression of the LpPHB3 gene under 20 mM NaHCO₃ treatment. (D). Relative expression of the LpPHB3 gene under 20 mM H₂O₂ treatment. No treatment (CK= 0) was used as the control

Conserved domain analysis revealed that the protein sequence possessed the conserved PHB domains (Fig. 1). From the alignment of the LpPHB3 deduced amino acid sequence, the LpPHB3 protein had the highest similarity (83.33%) with the HaPHB3 protein from Helianthus annuus (XP_022011535.1) (Fig. 2). Phylogenetic tree analysis was used to compare the LpPHB3 protein with some known homologous PHB3 proteins from a variety of plants (Fig. 3).

Expression of the LpPHB3 gene in L. pumilum

The highest expression of LpPHB3 was found in the bulb, followed by young leaves, flowers, roots, seeds and mature leaves (Fig. 4A). Under the stress of 300 mM NaCl, the expression of LpPHB3 reached its highest at 24 h, which was approximately 8 times the LpPHB3 expression in the control group (Fig. 4B). The expression of LpPHB3 increased suddenly at 12 h and reached its highest at 24 h, approximately 42 times the LpPHB3 expression in the control group under 20 mM NaHCO₃ stress (Fig. 4C). The expression of LpPHB3 remained constant for 12 h and then reached its highest at 24 h, approximately 2.4 times the LpPHB3 expression in the control group under 20 mM H₂O₂ stress (Fig. 4D).

Generation of an LpPHB3-overexpressing strain of L. pumilum

Fig. 5: A. The detection of LpPHB3 transgenic L. pumilum by PCR; DNA of 6 independent transgenic L. pumilum leaves was amplified using the PBI121 forward and reverse primer. B. The detection of LpPHB3 transgenic L. pumilum by qPCR analysis. Five transgenic lines (except #5) were selected for confirmation by qPCR analysis. WT, wild type; #2, #3, #4, #6, transgenic lines

Fig. 6: Relative stress tolerance of wild type and transgenic plants (#2, #3, #4) at the tissue culture bottle stage. Two-month-old seedlings were grown on medium supplemented either with 20 mM H₂O_2, 200 mM NaCl, or 20 mM NaHCO₃ or without (CK). WT, wild type; #2, #3, #4, transgenic lines

Fig. 7: Relative stress tolerance of wild type and transgenic plants (#2, #3, #4) at the spot culture stage. Plants were grown on soil supplemented either with 20 mM H₂O₂, 200 mM NaCl, or 20 mM NaHCO₃ or without (CK). WT, wild type; #2, #3, #4, transgenic lines

To investigate the function of LpPHB3, transgenic L. pumilum containing the construct 35S:LpPHB3 was generated. The wild type strain produced no PCR product. Transgenic lines #1, #2, #3, #4, and #6 had approximately 800 bp PCR bands using the primers PBI121F and the PBI121R we designed (Fig. 5A). This result indicates that the transgenic plants are positive. These independent lines were selected for qPCR, and the expression of LpPHB3 in transgenic plants was higher than that in wild type plants. As shown in Fig. 5B, transgenic lines #2, #3 and #4 had higher LpPHB3 expression levels and were selected for further research.

Comparison of stress resistance in transgenic plants and wild-type plants

The leaves showed signs of wilt under different levels of stress for 2 days-4 days. The leaves of the transgenic plants were green, while those of the wild-type plants were yellow under treatment with 200 mM NaCl, 20 mM NaHCO₃ or 20 mM H₂O₂ which indicated the increased resistance of the transgenic plants compared to the nontransgenic plants (Fig. 6). The effects of NaCl, NaHCO₃ and H₂O₂ on the transgenic plants and wild-type plants on several parts of the plants were examined (Fig. 7). The wild-type and transgenic lines grew well in medium without stress. Under stress induced by 300 mM NaCl, 300 mM NaHCO₃ or 2 M H₂O₂, the wild-type plants died, while the transgenic plants survived; furthermore, approximately 50, 20 and 10% of the transgenic plant leaves, respectively, wilted.

Measurements of physiological indices

There was no difference between the physiological indices of the wild type and transgenic plants under no treatment. No significant difference was observed between the physiological indices of the three kinds of transgenic plants after treatment. However, there were significant differences between the wild type and transgenic

Fig. 8: Physiological changes associated with stress response in wild type and transgenic lines. Seedlings were grown in MS and subsequently transferred to MS medium either with 200 mM NaCl, 20 mM NaHCO₃ or 20 mM H₂O₂ or without, and samples were harvested 24 h later. Physiological indices were detected in the leaves of seedlings. (A) Chlorophyll content. (B) Proline content. (C) Relative electrolyte leakage. (D) MDA content. Each data point is the average of five replicates, and error bars represent ± SE. Lower case letters a and b indicate significant differences among mean values within each plant at P < 0.05

plants (P<0.05) (Fig. 8). The content of chlorophyll in the wild type (21.12 mg·g^-1) and transgenic plants (22.98 mg·g^-1, 25.07 mg·g^-1, and 24.13 mg·g^-1) was similar under the usual conditions. The chlorophyll levels in the transgenic leaves were 15.01 mg·g^-1, 17.04 mg·g^-1, and 15.84 mg·g^-1, while that in the wild -type leaves was 10.31 mg·g^-1 under 200 mM NaCl. The chlorophyll levels in the transgenic leaves were 16.10 mg·g^-1, 17.57 mg·g^-1, and 16.33 mg·g^-1, while that in the wild type leaves was 10.15 mg·g^-1 under 20 mM NaHCO₃. The chlorophyll levels in the transgenic leaves were 16.34 mg·g^-1, 18.72 mg·g^-1, and 17.32 mg·g^-1, while that in the wild type leaves was 13.01 mg·g^-1 under 20 mM H₂O₂ treatment (Fig. 8A). Under control conditions, the proline content of the wild type (300 μg·g^-1) and transgenic plants (310 μg·g^-1, 364 μg·g^-1, and 305 μg·g^-1) was similar. The proline contents of the transgenic plants were 604 μg·g^-1, 674 μg·g^-1, and 578 μg·g^-1, while that of the wild type plants was 425 μg·g^-1 under 200 mM NaCl. The proline contents of the transgenic plants were 800 μg·g^-1, 836 μg·g^-1, and 763 μg·g^-1, while that of the wild type plants was 610 μg·g^-1 under 20 mM NaHCO₃. The proline content of transgenic plants was 1300 μg·g^-1, 1402 μg·g^-1, and 1294 μg·g^-1, while that of the wild type plants was 1006 μg·g^-1 under 20 mM H₂O₂ (Fig. 8B).

The levels of electrolyte leakage in the transgenic plants (20%) and wild type plants (21, 29 and 25%) were similar under control conditions. The electrolyte leakage levels in the transgenic plants were 50, 46 and 49%, while that in the wild type plants was 60% under 300 mM NaCl. The electrolyte leakage levels in the transgenic plants were 59, 47 and 52%, while that in the wild type plants was 66% under 20 mM NaHCO₃. The electrolyte leakage levels in the transgenic plants were 25, 21 and 23%, while that in the wild type plants was 32% under 20 mM H₂O₂ (Fig. 8C).

The MDA content of the wild type (0.005 mol·g^-1) and transgenic plants (0.01 mol·g^-1, 0.003 mol·g^-1, and 0.006 mol·g^-1) was similar under no stress conditions. Then, the MDA content in the wild type and transgenic plants increased under stress. The MDA content of the transgenic plants was 0.03 mol·g^-1, 0.025 mol·g^-1, and 0.037 mol·g^-1, while that of the wild type plants was 0.05 mol·g^-1 under 300 mM NaCl. The MDA content of the transgenic plants was 0.013 mol·g^-1, 0.02 mol·g^-1, and 0.017 mol·g^-1, while that of wild type plants was 0.029 mol·g^-1 under 20 mM NaHCO₃. The MDA content of the transgenic lines was 0.025 mol·g^-1, 0.021 mol·g^-1 and 0.015 mol·g^-1, while that of the wild type lines was 0.034 mol·g^-1 under 20 mM H₂O₂ treatment for 24 h (Fig. 8D).

Na⁺, K⁺ accumulation and Na⁺, K⁺ flux

There was no significant difference in Na⁺ content between wild type root systems (1.763 mg·g^-1) and transgenic root systems (0.999 mg·g^-1, 1. 635 mg·g^-1, 1. 1.925 mg·g^-1) under normal culture conditions. However, Na⁺ accumulation in the roots of plants increased when exposed to stresses; the Na⁺ content in the transgenic plants increased to 7.886 mg·g^-1, 9.236 mg·g^-1 and 8.325 mg·g^-1, which was apparently lower than that in wild type, 12.082 mg·g^-1, under 200 mM NaCl stress. The Na⁺ content in the transgenic plants increased to 1.626 mg·g^-1, 1.356 mg·g^-1, and 1.466 mg·g^-1, which was apparently lower than that in wild type, 2.004 mg·g^-1,

Fig. 9: Na⁺ and K⁺ content in wild type and transgenic lines. Two-month-old seedlings were grown on MS medium either with 200 mM NaCl or 20 mM NaHCO₃ or without, and samples were harvested 24 h later. A. Na⁺ contents in the roots of plants. B. K⁺ contents in the roots of plants. DW, dry weight

Fig. 10: Net K⁺ and Na⁺ flux in the root tips of wild type and transgenic L. pumilum. Two-month-old seedlings of wild type and transgenic L. pumilum were transferred to MS either with 200 mM NaCl or 20 mM NaHCO₃ or without for 24 h, and the seedlings were collected for NMT measurements. Each column shows the mean of six independent seedling flux rates within the measuring period of 0-20 min

under 20 mM NaHCO₃ stress (Fig. 9A).

The K⁺ levels in the roots of the wild type (73.717 mg·g^-1) and transgenic plants (75.912 mg·g^-1, 77.463 mg·g^-1, and 76.235 mg·g^-1) were similar under normal culture conditions. The transgenic plants had significantly higher K⁺ contents (74.781 mg·g^-1, 77.436 mg·g^-1, and 75.246 mg·g^-1) than the wild type plants (55.260 mg·g^-1) under 200 mM NaCl stress (Fig. 9B). The transgenic plants had significantly higher K⁺ contents (73.979 mg·g^-1, 70.464 mg·g^-1 and 75.426 mg·g^-1) than the wild type plants (60.414 mg·g^-1) under 20 mM NaHCO₃ stress (Fig. 9B). Under 200 mM NaCl or 20 mM NaHCO₃ stress, the K⁺/Na⁺ homeostasis ratios of LpPHB3 transgenic plants were 1.417 and 1.744 times higher than that of wild type plants, respectively.

NMT flux data showed that Na⁺ efflux in the root tips of all plants was significantly higher under salt conditions. Compared with the roots of wild type plants, the exudation rate of Na⁺ in the roots of the transgenic plants was significantly higher under 200 mM NaCl or 20 mM NaHCO₃ treatment for 24 h (Fig. 10A). We investigated the K⁺ flux in plants, and salt shock induced K⁺ efflux under 200 mM NaCl or 20 mM NaHCO₃ treatment. The average rate of K⁺ efflux in the transgenic strains was lower than that in the wild type strain (Fig. 10B). These observations indicated that LpPHB3 is involved in the regulation of K ⁺/Na ⁺ homeostasis under salt stress. In the figure, the positive values indicate outflows and the negative values indicate inflows.

ROS (O₂^-and H₂O₂) production in plant leaves under stresses

The stained leaf color of the wild type and transgenic plants showed no difference under no stress (Fig. 11). The wild type plant leaves showed a darker blue than the transgenic plant leaves under stresses (200 mM NaCl, 20 mM NaHCO₃ and 20 mM H₂O₂) for 24 h (Fig. 11A). The wild type plant leaves showed darker brown staining than the transgenic plant leaves under stresses (200 mM NaCl, 20 mM NaHCO₃ and 20 mM H₂O₂) for 24 h (Fig. 11B). This showed that more intercellular O₂^- and H₂O₂ accumulated in the leaves of the wild type plants than in the transgenic plants.

ROS stress-related gene expression in L. pumilum

Under normal conditions, ROS stress-related gene (AOX, NDB, APX, CAT) expression levels were very low, and no significant difference was observed in any of the plants. However, all four gene transcripts were increased under stress (Fig. 12).

Discussion

LpPHB3 was cloned from L. pumilum, and its transcriptional patterns were analysed to understand its function.

Fig. 11: Histochemical staining assay detection of O₂^- and H₂O₂ accumulation in leaves under 200 mM NaCl, 20 mM NaHCO₃, and 20 mM H₂O₂. A. Detection of O₂^- accumulation with NBT. B. Detection of H₂O₂ accumulation with DAB

Fig. 12: Expression of stress-responsive genes in wild type and transgenic lines. A. Relative expression of the AOX gene under stress treatment. B. Relative expression of the NDB gene under stress treatment. C. Relative expression of the APX gene under stress treatment. D. Relative expression of the CAT gene under stress treatment. CK, no treatment. NaCl, 200 mM NaCl; NaHCO₃, 20 mM NaHCO₃; H₂O₂, 20 mM H₂O₂

Leaf growth is more sensitive to salinity than root growth, and while the root regulates full expansion of the leaves of the shoot (Munns and Termaat 1986), the bulb carries out the same function as the root. Therefore, the bulb plays a particularly important role in the salt tolerance of plants. The highest expression of LpPHB3 was found in the bulbs of L. pumilum, and LpPHB3 expression was beneficial for improving plant tolerance.

LpPHB3 transcript levels were increased under stress conditions. This shows that salt can promote the expression of LpPHB3 and that the increased expression of LpPHB3 can protect against an adverse environment. In addition, this result shows that LpPHB3 is primarily related to salt stress.

We compared the stress tolerance of wild-type and transgenic plants grown in culture bottles and pots. The leaves of wild-type plants wilted and turned yellow, while the leaves of the transgenic plants grew normally and remained green. Transgenic L. pumilum appeared to exhibit more resistance to stress than the wild-type plants. LpPHB3 plays a role in improving tolerance to salt and oxidant stress. To study the stress tolerance mechanism induced by LpPHB3, we measured the physiological indices of wild-type and transgenic L. pumilum. The transgenic plants had higher chlorophyll and proline contents than the wild-type plants after stress treatment. Chlorophyll is the main pigment involved in photosynthesis, and proline is an important osmotic regulatory substance in plants (Delauney and Verma 1993; Cen et al. 2016; Kandoi et al. 2018). The results showed that compared to the wild-type lines, the transgenic lines could maintain a higher chlorophyll content to reduce photosynthetic system damage and a higher proline content to avoid excessive water loss caused by stress. MDA levels reflect the extent of membrane damage (Draper and Hadley 1990). The MDA content in LpPHB3 transgenic

Fig. 13: Model of LpPHB3 gene involvement in the stress response. Overexpressing LpPHB3 changed the physiological index, regulated the content and flux of K⁺ and Na⁺, and repressed ROS accumulation under salt stress conditions to tolerate elevated salt stress

L. pumilum was significantly lower than that in wild-type L. pumilum after stress, which indicates less damage to the transgenic plant membrane than to the wild-type plant membrane.

The degree of electrolyte leakage was used to evaluate abiotic stress tolerance, and the electrolyte leakage of the transgenic plants was lower than that of the wild-type plants, which indicated that stress-induced impairment of the transgenic lines was less pronounced than that of the wild-type lines.

Salinity stress causes K⁺ deficiency (Maathuis and Amtmann 1999). Na⁺ and K⁺ have similar binding sites, and Na⁺ competes with K⁺ in plants (Shabala and Cuin 2008). The transgenic plants exhibited a higher K⁺/Na⁺ ratio than the wild-type plants (Fig. 9).

LpPHB3 overexpression in L. pumilum activated a major salt tolerance mechanism through limiting the accumulation of Na⁺ to a high concentration. To further understand the role of LpPHB3 in K⁺/Na⁺ homeostasis, we used NMT to study stress-induced K⁺ and Na⁺ flux around the root tips of wild-type and transgenic plants; the results revealed that the net Na⁺ efflux was higher, but K⁺ efflux was lower in the transgenic lines than in the wild-type lines under 200 mM NaCl or 20 mM NaHCO₃ treatment (Fig. 10). These results suggested that LpPHB3 is involved in the regulation of K⁺/Na⁺ homeostasis under salt stress. Stress can lead to increased ROS production and cause oxidative damage to cellular components (Mittler 2002; Aken et al. 2009; Aken et al. 2010).

To understand whether the LpPHB3 protein can eliminate ROS produced by stress or reduce damage to plants caused by excess ROS, the cellular O₂^- and H₂O₂ levels in transgenic plants and wild-type plants were assessed by DAB and NBT staining. The O₂^- and H₂O₂ levels were higher in the wild-type plants than in the transgenic plants under stress (Fig. 11). Free radical-induced damage to the transgenic plants was less pronounced than that to the wild-type plants, indicating that the excessive expression of LpPHB3 improved the salt tolerance of the transgenic plants by increasing their antioxidant capacity.

Plants have a variety of antioxidant enzymes to balance ROS levels, preventing ROS from accumulating to toxic levels. These enzymes include ascorbate peroxidases (APXs) and catalases (CATs) (Jardimmesseder et al. 2018). The APX and CAT expression levels in transgenic plants were significantly higher than those in wild-type plants under the same stress conditions. AOX and NDB expression in plant mitochondria has been widely used as a model to study ROS stress. PHB protein levels were found to be upregulated in cultured tobacco cells with induced AOX expression, suggesting that PHB helps control the ROS content in the presence of AOX (Sieger et al. 2005). The loss of AtPHB2 and AtPHB6 resulted in the activation of other respiratory pathways (Piechota et al. 2015). We compared the levels of AOX and NDB transcripts in the transgenic plants and wild-type plants; based on the results, we speculate that LpPHB3 is related to AOX and NDB. The overexpression of LpPHB3 triggered the relative response to stress.

As shown by comparisons of the phenotype, physiological indices, ion storage and transportation, stress-related gene expression and the ROS content of plants overexpressing the LpPHB3 gene and wild-type plants under adverse conditions, the resistance of the transgenic plant system to stress was obviously higher than that of the wild-type plant system. LpPHB3 may directly or indirectly affect plant stress signals. Under saline-alkali stress, the expression of LpPHB3 may induce the expression of other salt tolerance-related genes, which together upregulate, reduce or eliminate excessive ROS produced by saline-alkali stress, thereby improving the salt-alkali resistance and antioxidation capacity of the plant.The exact mechanism for LpPHB3 participation in the stress response is not yet known, and we suggest the following model based on research results (Fig. 13): Overexpression of LpPHB3 enhances the salt stress tolerance of transgenic L. pumilum, and this may be associated with (1) changes in physiological indexes, (2) improved K⁺ and Na⁺ homeostasis under salt stress, and (3) repression of ROS accumulation.

Conclusion

LpPHB3 is mainly expressed in bulbs of L. pumilum. Through the comparison of transgenic and wild type physiological indices, Na⁺ and K⁺ accumulation, and ROS content, transgenic plants improved salt and oxidative resistance than wild type.

Acknowledgement

This work was supported by the Heilongjiang Province Nature Science Foundation (LH2019C011), Key Laboratory Open Fund of Saline-alkali Vegetation Ecology Restoration (SAVER1701).

References

Ahn CS, JH Lee, AR Hwang, WT Kim, HS Pai (2006). Prohibitin is involved in mitochondrial biogenesis in plants. Plant J 4:658‒667

Aken OV, J Whelan, FV Breusegem (2010). Prohibitins: Mitochondrial partners in development and stress response. Trends Plant Sci 5:275‒282

Aken OV, E Giraud, R Clifton, J Whelan (2009). Alternative oxidase: A target and regulator of stress responses. Physiol Plantarum 4:354‒361

Aken OV, T Pecenkova, BVD Cotte, RD Rycke, D Eeckhout, H Fromm, GD Jaeger, E Witters, GT Beemster, D Inze, FV Breusegem (2007). Mitochondrial type-I prohibitins of Arabidopsis thaliana are required for supporting proficient meristem development. Plant J 5:850‒864

Artal-Sanz M, WY Tsang, EM Willems, LA Grivell, BD Lemire, HVD Spek, LG Nijtmans (2003). The mitochondrial prohibitin complex is essential for embryonic viability and germline function in Caenorhabditis elegans. J Biol Chem 34:32091‒32099

Bates LS, RP Waldren, ID Teare (1973). Rapid determination of free proline for water-stress studies. Plant Soil 39:205‒207

Cáceres FFND, MR Davey, ZA Wilson (2011). A rapid and efficient agrobacterium-mediated transformation protocol for lilium. Acta Hortic 900:161‒167

Cen H, W Ye, Y Liu, D Li, K Wang, W Zhang (2016). Overexpression of a chimeric gene, OsDST-SRDX, improved salt tolerance of perennial ryegrass. Sci Rep 6; Article 27320

Coates PJ, DJ Jamieson, K Smart, AR Prescott, PA Hall (1997). The prohibitin family of mitochondrial proteins regulate replicative lifespan. Curr Biol 8:607‒610

Delauney AJ, DPS Verma (1993). Proline biosynthesis and osmoregulation in plants. Plant J 4:215‒223

Draper HH, M Hadley (1990). Malondialdehyde determination as index of lipid peroxidation. Meth Enzymol186:421‒431

Farooq M, A Wahid, N Kobayashi, D Fujita, SMA Basra (2009) Plant drought stress: Effects, mechanisms and management. Agron Sustain Dev 29:185-212.

Heath RL, L Packer (1968). Photoperoxidation in isolated chloroplasts. I. Kinetics and stoichiometry of fatty acid peroxidation. Arch Biochem Biophys 125:189‒198

Hoffmann A, E Hammes, C Plieth, C Desel, B Sattelmacher, UP Hansen (2005). Effect of CO₂ supply on formation of reactive oxygen species in Arabidopsis thaliana. Protoplasma 227:3‒9

Jardimmesseder D, A Caverzan, R Rauber, JR Cunha, FE Carvalho, ML Gaeta, GCD Fonseca, JM Costa, M Frei, JAG Silveira, R Margis, JM Nelson, Saibo, M Margispinheiro (2018). Thylakoidal APX modulates hydrogen peroxide content and stomatal closure in rice (Oryza sativa L.). Environ Exp Bot 150:46‒56

Kandoi D, S Mohanty, BC Tripathy (2018). Overexpression of plastidic maize NADP-malate dehydrogenase (ZmNADP-MDH) in Arabidopsis thaliana confers tolerance to salt stress. Protoplasma 255:547‒563

Lee CH, S Choi, J Kim, SH Kim, K Yoon, J Oh, MS Lee (2015). Overexpression of prohibitin-1 inhibits RANKL-induced activation of p38-Elk-1-SRE signaling axis blocking MKK6 activity. Biochem Biophys Res Commun 463:1028‒1033

Liang Y, SX Yuan, HY Feng (2013). Cloning and expression analysis of actin gen (lilyActin) from lily. Acta Hortic Sin 40:1318‒1326

Maathuis FJM, A Amtmann (1999). K⁺ Nutrition and Na⁺ toxicity: The basis of cellular K⁺/Na⁺ ratios. Ann Bot 84:123‒133

McClung JK, DB Danner, DA Stewart, JR Smith, EL Schneider, CK Lumpkin, RT Dell'Orco, MJ Nuell (1989). Isolation of a cDNA that hybrid selects antiproliferative mRNA from rat liver. Biochem Biophys Res Commun 3:1316‒1322

Merkwirth C, T Langer (2009). Prohibitin function within mitochondria: Eessential roles for cell proliferation and cristae morphogenesis. Biochim Biophys Acta 1793:27‒32

Merkwirth C, S Dargazanli, T Tatsuta, S Geimer, B Lower, FT Wunderlich, J von Kleist-Retzow, A Waisman, B Westermann, T Langer (2008). Prohibitins control cell proliferation and apoptosis by regulating OPA1-dependent cristae morphogenesis in mitochondria. Genes Dev 22:476‒488

Mittler R (2002). Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci 9:405‒410

Munns R, A Termaat (1986). Whole-plant responses to salinity. Funct Plant Biol 13:143-160

Murashige T, F Skoog (1962). A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol Plantarum 3:473‒497

Piechota J, M Bereza, A Sokolowska, K Suszynski, K Lech, H Janska (2015). Unraveling the functions of type II-prohibitins in Arabidopsis mitochondria. Plant Mol Biol 88:249‒267

Proscevičius (2010). Employment of species Lilium pumilum DC and L. concolor Salisb. For breeding of small flowering lilies. Vytaut Didž Univ. Bot Sodo Rašt14:139‒144

Seguel A, J Jelenska, A Herrera-Vásquez, SK Marr, MB Joyce, KR Gagesch, N Shakoor, SC Jiang, A Fonseca, MC Wildermuth, JT Greenberg (2018). PROHIBITIN 3 forms complexes with ISOCHORISMATE SYNTHASE 1 to regulate stress-induced salicylic acid biosynthesis in Arabidopsis. Plant Physiol 176:2515-2531

Shabala S, TA Cuin (2008). Potassium transport and plant salt tolerance. Physiol Plantarum 133:651‒669

Sieger SM, BK Kristensen, CA Robson, S Amirsadeghi, EW Eng, A Abdel-Mesih, IM Moller, GC Vanlerberghe (2005). The role of alternative oxidase in modulating carbon use efficiency and growth during macronutrient stress in tobacco cells. J Exp Bot 56:1499‒1515

Takahashi A, T Kawasaki, HL Wong, U Suharsono, H Hirano, K Shimamoto (2003). Hyperphosphorylation of a mitochondrial protein, prohibitin, is induced by calyculin A in a rice lesion-mimic mutant cdr1. Plant Physiol 132:1861‒1869

Tang N, G Mo, J Tuyl, P Arens, J Liu, D Tang (2014). Genetic diversity and structure of Lilium pumilum DC. in southeast of Qinghai–Tibet plateau. Plant Syst Evol 300:1453‒1464

Tu MX, XH Wang, L Huang, RR Guo, HJ Zhang, JS Cai, XP Wang (2016). Expression of a grape bZIP transcription factor, VqbZIP39, in transgenic Arabidopsis thaliana confers tolerance of multiple abiotic stresses. Plant Cell Tiss Org 125:537‒551

Vandenabeele S, KVD Kelen, J Dat, I Gadjev, T Boonefaes, S Morsa, P Rottiers, L Slooten, MV Montagu, M Zabeau, D Inze, FV Breusegem (2003). A comprehensive analysis of hydrogen peroxide-induced gene expression in tobacco. Proc Natl Acad Sci USA 100:16113‒16118

Wang Y, A Ries, K Wu, A Yang, NM Crawford (2010). The Arabidopsis prohibitin gene PHB3 functions in nitric oxide-mediated responses and in hydrogen peroxide-induced nitric oxide accumulation. Plant Cell 22:249‒259

Xin S, Yu G, L Sun, X Qiang, N Xu, X Cheng (2014). Expression of tomato SlTIP2; 2 enhances the tolerance to salt stress in the transgenic Arabidopsis and interacts with target proteins. J Plant Res 127:695‒708

Zhao X, X Chen, D Li, K Liu (1996). Resources and research situation of the genus Lilium in China. Acta Hortic 414:59‒68

Zhou TB, YH Qin, FY Lei, WF Huang, GPC Drummen (2014). Association of prohibitin-1 and 2 with oxidative stress in rats with renal interstitial fibrosis. Mol Biol Rep 41:3033‒3043

Zhou ZL, ZC Feng, CY Fu, HL Zhang, JM Xia (2012). Steroidal and phenolic glycosides from the bulbs of Lilium pumilum DC and their potential Na⁺/K⁺ ATPase inhibitory activity. Molecules 17:10494‒10502